ID: 1136807223

View in Genome Browser
Species Human (GRCh38)
Location 16:33141067-33141089
Sequence CAGCCTGGGCACACCCGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807212_1136807223 14 Left 1136807212 16:33141030-33141052 CCCTGCGCACCAGGTGAGGGCGA No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807207_1136807223 26 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807216_1136807223 5 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807220_1136807223 -10 Left 1136807220 16:33141054-33141076 CCCGGGCGCAGCTCAGCCTGGGC No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807218_1136807223 -9 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807208_1136807223 23 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807213_1136807223 13 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807223 Original CRISPR CAGCCTGGGCACACCCGAGA GGG Intergenic