ID: 1136807230

View in Genome Browser
Species Human (GRCh38)
Location 16:33141080-33141102
Sequence CCCGAGAGGGGACCAGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807212_1136807230 27 Left 1136807212 16:33141030-33141052 CCCTGCGCACCAGGTGAGGGCGA No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807220_1136807230 3 Left 1136807220 16:33141054-33141076 CCCGGGCGCAGCTCAGCCTGGGC No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807216_1136807230 18 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807221_1136807230 2 Left 1136807221 16:33141055-33141077 CCGGGCGCAGCTCAGCCTGGGCA No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807213_1136807230 26 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807218_1136807230 4 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807230 Original CRISPR CCCGAGAGGGGACCAGGCCG GGG Intergenic