ID: 1136807233

View in Genome Browser
Species Human (GRCh38)
Location 16:33141086-33141108
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807216_1136807233 24 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807233 16:33141086-33141108 AGGGGACCAGGCCGGGGGCCAGG No data
1136807220_1136807233 9 Left 1136807220 16:33141054-33141076 CCCGGGCGCAGCTCAGCCTGGGC No data
Right 1136807233 16:33141086-33141108 AGGGGACCAGGCCGGGGGCCAGG No data
1136807221_1136807233 8 Left 1136807221 16:33141055-33141077 CCGGGCGCAGCTCAGCCTGGGCA No data
Right 1136807233 16:33141086-33141108 AGGGGACCAGGCCGGGGGCCAGG No data
1136807218_1136807233 10 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807233 16:33141086-33141108 AGGGGACCAGGCCGGGGGCCAGG No data
1136807225_1136807233 -7 Left 1136807225 16:33141070-33141092 CCTGGGCACACCCGAGAGGGGAC No data
Right 1136807233 16:33141086-33141108 AGGGGACCAGGCCGGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807233 Original CRISPR AGGGGACCAGGCCGGGGGCC AGG Intergenic