ID: 1136807238

View in Genome Browser
Species Human (GRCh38)
Location 16:33141093-33141115
Sequence CAGGCCGGGGGCCAGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807220_1136807238 16 Left 1136807220 16:33141054-33141076 CCCGGGCGCAGCTCAGCCTGGGC No data
Right 1136807238 16:33141093-33141115 CAGGCCGGGGGCCAGGGGCCGGG No data
1136807229_1136807238 -10 Left 1136807229 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
Right 1136807238 16:33141093-33141115 CAGGCCGGGGGCCAGGGGCCGGG No data
1136807225_1136807238 0 Left 1136807225 16:33141070-33141092 CCTGGGCACACCCGAGAGGGGAC No data
Right 1136807238 16:33141093-33141115 CAGGCCGGGGGCCAGGGGCCGGG No data
1136807221_1136807238 15 Left 1136807221 16:33141055-33141077 CCGGGCGCAGCTCAGCCTGGGCA No data
Right 1136807238 16:33141093-33141115 CAGGCCGGGGGCCAGGGGCCGGG No data
1136807218_1136807238 17 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807238 16:33141093-33141115 CAGGCCGGGGGCCAGGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807238 Original CRISPR CAGGCCGGGGGCCAGGGGCC GGG Intergenic