ID: 1136807248

View in Genome Browser
Species Human (GRCh38)
Location 16:33141105-33141127
Sequence CAGGGGCCGGGGGGAGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807218_1136807248 29 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data
1136807231_1136807248 1 Left 1136807231 16:33141081-33141103 CCGAGAGGGGACCAGGCCGGGGG No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data
1136807221_1136807248 27 Left 1136807221 16:33141055-33141077 CCGGGCGCAGCTCAGCCTGGGCA No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data
1136807229_1136807248 2 Left 1136807229 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data
1136807236_1136807248 -10 Left 1136807236 16:33141092-33141114 CCAGGCCGGGGGCCAGGGGCCGG No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data
1136807220_1136807248 28 Left 1136807220 16:33141054-33141076 CCCGGGCGCAGCTCAGCCTGGGC No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data
1136807225_1136807248 12 Left 1136807225 16:33141070-33141092 CCTGGGCACACCCGAGAGGGGAC No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807248 Original CRISPR CAGGGGCCGGGGGGAGGGGC GGG Intergenic