ID: 1136811550

View in Genome Browser
Species Human (GRCh38)
Location 16:33180864-33180886
Sequence AAAGTGGGACTCTAATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136811547_1136811550 -2 Left 1136811547 16:33180843-33180865 CCTGGTGCATTTAGGTGGGGTAA No data
Right 1136811550 16:33180864-33180886 AAAGTGGGACTCTAATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136811550 Original CRISPR AAAGTGGGACTCTAATAGAG AGG Intergenic
No off target data available for this crispr