ID: 1136811572

View in Genome Browser
Species Human (GRCh38)
Location 16:33180976-33180998
Sequence GCCAGATCTTCGCCTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136811572_1136811575 14 Left 1136811572 16:33180976-33180998 CCTGTAACAGGCGAAGATCTGGC No data
Right 1136811575 16:33181013-33181035 TTCCAGCATCATTGCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136811572 Original CRISPR GCCAGATCTTCGCCTGTTAC AGG (reversed) Intergenic
No off target data available for this crispr