ID: 1136818026

View in Genome Browser
Species Human (GRCh38)
Location 16:33290944-33290966
Sequence AAAGTGGGACTCTAATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 6, 1: 1, 2: 3, 3: 8, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136818023_1136818026 -2 Left 1136818023 16:33290923-33290945 CCTGGTGCATTTAGGTGGGGTAA 0: 8
1: 0
2: 2
3: 9
4: 84
Right 1136818026 16:33290944-33290966 AAAGTGGGACTCTAATAGAGAGG 0: 6
1: 1
2: 3
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136818026 Original CRISPR AAAGTGGGACTCTAATAGAG AGG Intronic
903437427 1:23361589-23361611 AACGTGGGACTGTAATAGGGTGG - Exonic
904056427 1:27673540-27673562 CAAATGGGGCTGTAATAGAGTGG + Intergenic
908307394 1:62836345-62836367 ATAGTGGGACACTTATAGAATGG + Intronic
911138365 1:94467986-94468008 AAAATGGGACACTAATTGAAAGG + Exonic
917946591 1:179978912-179978934 AAAGTGAGTCTCTTATAGACAGG + Intronic
918575956 1:186060526-186060548 AAAGTGAAACTCTAATATACTGG - Intronic
920450581 1:206058404-206058426 AAAGTGAGAGTCTCAAAGAGGGG + Intronic
1063242129 10:4181618-4181640 AAAGTGGCATTCTAAAAGAAAGG + Intergenic
1064443845 10:15376142-15376164 AAAGTAGAACTCTAAGACAGGGG - Intergenic
1065999313 10:31089498-31089520 AAGGTTGGACTCTAAATGAGAGG + Intergenic
1069308164 10:66998572-66998594 AAAGTGAGACACTTGTAGAGAGG + Intronic
1071025681 10:81110137-81110159 AATGTGGGAATCTAATAAATTGG - Intergenic
1071084709 10:81856465-81856487 AAAGTGTGTCTCTTATAGAGAGG + Intergenic
1077416889 11:2428165-2428187 AAACAGGGACTCTAATAGCCTGG + Intergenic
1081537304 11:44005182-44005204 AGAGTGGGACTCTTGTCGAGGGG - Intergenic
1082823611 11:57561821-57561843 CAAGATGGACTCTAAAAGAGGGG - Intronic
1083717773 11:64588330-64588352 AAAGAGGGGCTCAAATGGAGGGG + Intergenic
1084025156 11:66443469-66443491 AGAGTGGGACTCTGGGAGAGAGG - Intronic
1084730692 11:71071705-71071727 AAAGTGGGACTCCAGCAGAGTGG + Intronic
1086199806 11:84188315-84188337 AAAATGTGACTGTAATTGAGAGG - Intronic
1087234657 11:95704783-95704805 AAAGTGTTATTCTAATGGAGAGG + Intergenic
1088097312 11:106115885-106115907 AAAGGGGGATTTTAATAAAGTGG + Intergenic
1090772584 11:129934270-129934292 CAAGTGGGCATTTAATAGAGTGG + Intronic
1090936080 11:131343789-131343811 GAAGTGGGACGCTCATACAGAGG + Intergenic
1091161342 11:133423865-133423887 AAAGAGGGAGCCAAATAGAGGGG - Intronic
1098714338 12:73810688-73810710 AAACAGGGACTGTAATAGGGAGG - Intergenic
1106858536 13:33879681-33879703 ACAATAGGAATCTAATAGAGAGG - Intronic
1107361630 13:39624637-39624659 AAAGTGTTACTCAAATACAGAGG - Intergenic
1110512223 13:76364264-76364286 AAACTAGGAGTCTAAAAGAGAGG + Intergenic
1112922137 13:104627052-104627074 ACAGGTGGACTTTAATAGAGTGG + Intergenic
1115978876 14:39027670-39027692 AAACTGCAACTCTAAGAGAGGGG - Intergenic
1116691099 14:48106666-48106688 AATGTGGAAGTATAATAGAGAGG + Intergenic
1117477256 14:56108737-56108759 AGAACGGGATTCTAATAGAGTGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1121684703 14:95827119-95827141 AAATTGGGATTCTATTAGAAAGG + Intergenic
1124555517 15:30721497-30721519 GAAGTGGAACTCAAATGGAGTGG - Intronic
1124675746 15:31684198-31684220 GAAGTGGAACTCAAATGGAGTGG + Intronic
1125419528 15:39490276-39490298 AAAGTAGGAGACTAAAAGAGTGG - Intergenic
1125460585 15:39902947-39902969 AAAGTGGAACTCTCATAGGTTGG - Intronic
1128377703 15:67089129-67089151 AAAGTGGGCCTTTAAAAAAGGGG + Intronic
1133397197 16:5457464-5457486 AAAGTGGAACTCTAATGAATGGG - Intergenic
1134560045 16:15201029-15201051 AAAGGGAGACTCCAATTGAGGGG - Intergenic
1134920584 16:18112639-18112661 AAAGGGAGACTCCAATTGAGGGG - Intergenic
1136711347 16:32239896-32239918 AAAGTGGGAACCTAATAGAGAGG + Intergenic
1136756560 16:32689509-32689531 AAAGTGGGACTCTAATAGAGAGG - Intergenic
1136811550 16:33180864-33180886 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1136818026 16:33290944-33290966 AAAGTGGGACTCTAATAGAGAGG + Intronic
1136824590 16:33347473-33347495 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1136829656 16:33446244-33446266 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1137031348 16:35527042-35527064 AAGATGGGACCCTAATAGAGAGG - Intergenic
1137271277 16:46903908-46903930 AACGAGGGGCTCTAATGGAGAGG + Intronic
1202990128 16_KI270728v1_random:3833-3855 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1203058709 16_KI270728v1_random:949863-949885 AAAGTGGGACCCTAATAGAGAGG - Intergenic
1143931359 17:10430792-10430814 AAAATGGGACTAAAAGAGAGAGG - Intergenic
1144241732 17:13319371-13319393 AAAGTGGGTCTCCACTTGAGTGG - Intergenic
1146308307 17:31747496-31747518 AAAGTGGGACCCTAAGGCAGAGG + Intergenic
1150855869 17:68752042-68752064 GAACTGGGACTCTAATATAGAGG + Intergenic
1156718547 18:40041989-40042011 AAAGAGGGACTCTTAGAGAAGGG - Intergenic
1159761508 18:72432010-72432032 AAAGTGAGACTCAGAGAGAGAGG + Intergenic
1163934184 19:20426582-20426604 AAAGTGAGAGTCTCAAAGAGAGG - Intergenic
1166826983 19:45615965-45615987 AAAGTGGAAGTCAAATACAGAGG + Intronic
1167910032 19:52694283-52694305 AAAGTGAGACTCTCAAAGGGGGG + Intergenic
927265601 2:21145886-21145908 AAAAAGGGACTCTATTACAGTGG + Intergenic
933890863 2:86768542-86768564 AAAGTTGGACTGTATTAGAGTGG + Intronic
937056089 2:118938253-118938275 TAAGGGGGACTCTACCAGAGTGG - Intergenic
943373652 2:187048495-187048517 ACACTGGGACTCCAAAAGAGTGG - Intergenic
943906943 2:193511326-193511348 AAAATGGGACCCCAATAGGGAGG + Intergenic
1170412313 20:16104835-16104857 AAAGTTGGACTCTTATCTAGGGG + Intergenic
1170686848 20:18576929-18576951 AGAGTGGGACTATAATAGAGTGG - Intronic
1170784424 20:19455178-19455200 AAAGCGGGACCCTGTTAGAGAGG + Intronic
1172639936 20:36434771-36434793 AAAGTGGGCCTCTGACACAGAGG + Intronic
1176521057 21:7824776-7824798 ACAGTTGGACTCAAACAGAGTGG + Intronic
1178633023 21:34279037-34279059 AATATGTGACTCTAATAGTGAGG - Intergenic
1178655077 21:34454788-34454810 ACAGTTGGACTCAAACAGAGTGG + Intergenic
1178675312 21:34626394-34626416 GGAGTGGGACTCTAGGAGAGGGG - Intergenic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
956623238 3:71241600-71241622 AAAGTGGGCTTATAAGAGAGGGG + Intronic
960619902 3:119627670-119627692 CAAGTGGGACTCTGAAAAAGAGG - Intronic
960676148 3:120196691-120196713 ATAGTGGTACTCAAATAAAGTGG - Intronic
964364674 3:155936985-155937007 AAAGTGAGACTCTATTAGTTGGG + Intronic
970122916 4:12777374-12777396 TGAGTGGGACTGTAATATAGAGG - Intergenic
970878814 4:20903923-20903945 AAATTGATAATCTAATAGAGTGG - Intronic
971108651 4:23556964-23556986 AACATGGGACTCTAATATATTGG + Intergenic
971636413 4:29065000-29065022 AAAGTGGAACTCTAATGAATGGG + Intergenic
972093310 4:35316608-35316630 AGAGTGGGTTTCTAATAAAGTGG + Intergenic
974059768 4:57021383-57021405 AAACTGGGAATTTAGTAGAGGGG + Intronic
983764465 4:171460555-171460577 AAAGTGGGAATAGAATAGAAAGG + Intergenic
984612058 4:181852189-181852211 AAAGTGGGACACTAAAACATCGG + Intergenic
989764766 5:45068972-45068994 AATGTGGGACTGTAATAGGCCGG + Intergenic
992646278 5:78814515-78814537 AGAGTGGGCCTTTAAAAGAGAGG - Intronic
993491305 5:88553854-88553876 AAATTGGGACCTTAAAAGAGAGG - Intergenic
994315628 5:98329818-98329840 AACATGGGACTCTAAGATAGAGG + Intergenic
996134883 5:119829298-119829320 AAAGTGGGACTGTAAAAGAGGGG + Intergenic
1003270644 6:4605006-4605028 AAAGTGGGACTCCAATGAACAGG - Intergenic
1006570934 6:35003798-35003820 AAAGTGAGAGTCTCAAAGAGGGG + Intronic
1010533560 6:76995535-76995557 AAAGTGGGACTCTAATGCACAGG + Intergenic
1015775808 6:136812920-136812942 AAGGTGGGACACTCAGAGAGGGG - Intergenic
1016530499 6:145054029-145054051 AAAGTTGAACTCTAAAAGAAGGG + Intergenic
1016531297 6:145060321-145060343 GAAGTGGGTCTCTAATTCAGTGG - Intergenic
1017655766 6:156627685-156627707 AAAGTGGGAGTGGAACAGAGAGG - Intergenic
1024338404 7:48232882-48232904 CAAGTGGGACTCTAAGAAAAAGG + Intronic
1027439161 7:78199194-78199216 AAAGTGGGACTGAATAAGAGAGG + Intronic
1027828634 7:83149447-83149469 AAAGTGGGACTTGAAGATAGAGG + Intronic
1030330029 7:108261017-108261039 AAAGGGGGACACTGATGGAGGGG + Intronic
1030656333 7:112172352-112172374 AAAATAGGACCCTAAAAGAGAGG - Intronic
1031550939 7:123110716-123110738 AAGGTGGAACTCTAAGAGGGAGG - Intergenic
1035249192 7:157585876-157585898 AAAATGGGACTCAAGTAGAAAGG - Intronic
1035371902 7:158385198-158385220 ACAGTGGGACTCACATAGTGTGG - Intronic
1039789592 8:40864391-40864413 AAAGTGGGTCTCTAATGCTGGGG + Intronic
1040397498 8:47013562-47013584 AAGCCTGGACTCTAATAGAGGGG + Intergenic
1042293214 8:67191630-67191652 AATGTGGGATACTAATACAGTGG - Intronic
1043839875 8:85090036-85090058 GAAGGGGGTCTCTAATACAGTGG + Intergenic
1044484126 8:92730106-92730128 ACAATGATACTCTAATAGAGAGG + Intergenic
1046965510 8:120160956-120160978 AAAGAGGGACTCTAATATACAGG + Intronic
1047312562 8:123704849-123704871 AAGGAGTGACTCCAATAGAGAGG - Intronic
1048146233 8:131846564-131846586 AAATGGGGTCACTAATAGAGAGG + Intergenic
1048221748 8:132548689-132548711 AAAGCTGGGCTCTATTAGAGAGG - Intergenic
1048954382 8:139523494-139523516 TAATTGGGTCTCTAATAGACTGG + Intergenic
1049595020 8:143479313-143479335 AAATTGTGACCCTAATGGAGAGG + Intronic
1053026977 9:34738313-34738335 AAATTGGGACTCTGACAAAGGGG - Intergenic
1059680418 9:116580307-116580329 GGAGTAGGTCTCTAATAGAGGGG + Intronic
1186386048 X:9111219-9111241 AAAATGTCACTCTCATAGAGTGG - Intronic
1195092007 X:101469734-101469756 AAGGTGGGACTCTACTCCAGGGG + Intronic
1199391722 X:147287733-147287755 AAAGTGGGAGGGCAATAGAGTGG - Intergenic
1200978227 Y:9236488-9236510 AGAGTGAGACTCTGTTAGAGAGG - Intergenic