ID: 1136818048

View in Genome Browser
Species Human (GRCh38)
Location 16:33291056-33291078
Sequence GCCAGATCTTCGCCTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 9, 1: 0, 2: 3, 3: 202, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136818048_1136818051 14 Left 1136818048 16:33291056-33291078 CCTGTAACAGGCGAAGATCTGGC 0: 9
1: 0
2: 3
3: 202
4: 243
Right 1136818051 16:33291093-33291115 TTCCAGCATCATTGCCAGCCAGG 0: 6
1: 3
2: 1
3: 29
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136818048 Original CRISPR GCCAGATCTTCGCCTGTTAC AGG (reversed) Intronic
900077183 1:827288-827310 GCCAGATCTGCGTCTGTGTCCGG - Intergenic
900434961 1:2625612-2625634 GACAGCTCTTGGCCCGTTACTGG + Intronic
900461681 1:2804891-2804913 GCCAGAGCTGCACCTGTTCCCGG - Intergenic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
904179491 1:28655935-28655957 GACAGCTCTTGGCCTATTACTGG - Intergenic
904335935 1:29798022-29798044 GACAGCTCTTGGCCTATTACTGG + Intergenic
905465227 1:38148135-38148157 AACAGCTCTTAGCCTGTTACTGG + Intergenic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
911738395 1:101361883-101361905 CACAGCTCTTGGCCTGTTACTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
912943810 1:114068168-114068190 GACAGCTTTTAGCCTGTTACTGG - Intergenic
913039444 1:115008359-115008381 GACAGCTCTTGTCCTGTTACTGG - Intergenic
915004161 1:152621554-152621576 GCCAGATATTTGGGTGTTACAGG + Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
917217211 1:172690877-172690899 GGCAGCTCTTGGTCTGTTACTGG - Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918774495 1:188610783-188610805 GACATCTCTTTGCCTGTTACTGG + Intergenic
918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG + Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
921699486 1:218251461-218251483 GGCAGAGCTTCTTCTGTTACTGG + Intergenic
922219164 1:223544540-223544562 CCAAGATCTCTGCCTGTTACTGG - Intronic
922438874 1:225634520-225634542 GCCAGATAATTCCCTGTTACAGG - Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924182506 1:241453205-241453227 GACAGTTCTTGGCCTGCTACTGG - Intergenic
924344934 1:243064881-243064903 GCCAGTTCATCTCCTATTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1064545686 10:16448099-16448121 GACAGCTCTTGGCCAGTTACTGG - Intronic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1067125551 10:43512508-43512530 GACAGTTCTTGGCCTATTACTGG - Intergenic
1068007671 10:51409534-51409556 GACAGCTCTTGGCCTGTCACTGG - Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069192303 10:65506334-65506356 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1069790829 10:71019547-71019569 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071267084 10:83973966-83973988 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG + Intergenic
1072209256 10:93231642-93231664 GACAGATCTTGGCTTGTTACTGG - Intergenic
1073557351 10:104465936-104465958 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1073656679 10:105424448-105424470 TACAGCTCTTGGCCTGTTACTGG - Intergenic
1073830503 10:107377973-107377995 GACAGTTCTTGGCCTATTACTGG - Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG + Intronic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076927414 10:133499190-133499212 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1079134287 11:17767691-17767713 GCCTGATCTTCCTCTGTTACAGG - Intronic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG + Intergenic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1082999663 11:59279889-59279911 GAGAGTTCTTGGCCTGTTACTGG + Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088191659 11:107234480-107234502 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1088588291 11:111379168-111379190 GCCAGAGCATGGCCTGTGACAGG + Exonic
1088836657 11:113583399-113583421 GACAGCTCTTGGCCTGTCACTGG + Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090221614 11:125031575-125031597 GACAGCTCTTAGCCTGTTACTGG - Intronic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1093645730 12:21583681-21583703 GAAAGCTCTTGGCCTGTTACTGG + Intronic
1095603855 12:44044345-44044367 GACAGCTCTTGGCCTGTTTCTGG + Intronic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1096288713 12:50322971-50322993 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1096457465 12:51799426-51799448 GACGGCTCTTGGCCTGTTACTGG - Intronic
1096744462 12:53716346-53716368 GCCAGCTCTTCGCCTCCTTCAGG + Exonic
1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG + Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097564647 12:61252418-61252440 GACAGCTCTTGACCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1097843356 12:64342750-64342772 AACAGCTCTTGGCCTGTTACTGG - Intronic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098716091 12:73829826-73829848 GACAGTTCTTGGCCCGTTACTGG + Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1099508562 12:83507198-83507220 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG + Intergenic
1099689781 12:85938048-85938070 GACAGCTCTTTGTCTGTTACTGG + Intergenic
1100083304 12:90878223-90878245 GACAGCTCTTTGCCTGTTACTGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG + Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1105996442 13:25677030-25677052 GCCAGATCATTGCCTGGGACAGG + Intronic
1107983575 13:45755961-45755983 GACAGCTCTTGGCCTATTACTGG - Intergenic
1108302433 13:49091974-49091996 GACAGCTCTTGGCCCGTTACTGG - Intronic
1109293225 13:60500129-60500151 GACGGCTCTTGGCCTGTTACTGG + Intronic
1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111317503 13:86581812-86581834 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
1111432252 13:88159623-88159645 GACAGATCTTGGCCTGCTACTGG - Intergenic
1112249926 13:97770267-97770289 GACAGCTCTTGGGCTGTTACTGG - Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1114758257 14:25283865-25283887 GATAGCTCTTCACCTGTTACTGG - Intergenic
1115130694 14:30049271-30049293 GACAGCTCTTGGCCTGTCACTGG + Intronic
1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG + Intergenic
1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1116308043 14:43283436-43283458 GACAGCTCTTGGCCTGCTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1117638206 14:57769680-57769702 GCCACATCATCCCCTGCTACAGG + Intronic
1118122433 14:62860159-62860181 GACAGCTCTTAGCCTGTTACTGG - Intronic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119059696 14:71462179-71462201 GACAGCTCTTTGTCTGTTACTGG - Intronic
1119107563 14:71938828-71938850 GACAGCTCTTGGCCTATTACTGG - Intronic
1120082024 14:80227519-80227541 GACAGCTCTTTGCCTGTTCCTGG - Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1120555991 14:85930427-85930449 AGCAGCTCTTGGCCTGTTACTGG - Intergenic
1120888043 14:89467244-89467266 CCCACAGCTTCGCCTGTTCCCGG + Intronic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1128568813 15:68718676-68718698 GCCACATGTGTGCCTGTTACAGG + Exonic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1133910209 16:10059060-10059082 CCAAGTTCTTCTCCTGTTACAGG - Intronic
1135626004 16:23995507-23995529 GACAGCTCTTGGCCTGCTACCGG + Intronic
1136711370 16:32240008-32240030 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1136756539 16:32689397-32689419 GCCAGATCTTCGCCTGTTACAGG + Intergenic
1136811572 16:33180976-33180998 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1136818048 16:33291056-33291078 GCCAGATCTTCGCCTGTTACAGG - Intronic
1136824612 16:33347585-33347607 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1136829678 16:33446356-33446378 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1137031325 16:35526930-35526952 GCCAGATCTTCGCCTGTTACAGG + Intergenic
1137480896 16:48851087-48851109 GCCAGATCTTCTGATATTACAGG - Intergenic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1202990150 16_KI270728v1_random:3945-3967 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1203058685 16_KI270728v1_random:949751-949773 GCCAGATCTTCGCCTGTTACAGG + Intergenic
1142739288 17:1921344-1921366 GCCAGTTCTTAGCCTTTTTCAGG + Intergenic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1146850934 17:36221051-36221073 GACAGCTCTTAGCCTGTTACTGG + Intronic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1155940708 18:31799605-31799627 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156582551 18:38394471-38394493 GACAGCTCTTAGCCTATTACTGG + Intergenic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159152205 18:64535031-64535053 GACAGCTCTTGGCATGTTACTGG - Intergenic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159559104 18:69975344-69975366 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1163026967 19:14518146-14518168 GCGAGATCTTCGACCGCTACGGG - Exonic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1165052611 19:33151579-33151601 GCCAGACCTTCCCATTTTACAGG - Intronic
1166060449 19:40322321-40322343 GCCAGATCCTCGTCCGTTTCTGG + Exonic
925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG + Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG + Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927085354 2:19669773-19669795 GCCACATGTTGGCCTGTTATGGG + Intergenic
927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG + Intergenic
929269825 2:39960774-39960796 AACAGCTCTTGGCCTGTTACTGG - Intergenic
932870706 2:75395074-75395096 GACAGCTCCTGGCCTGTTACTGG - Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935425109 2:102911318-102911340 TACAGCTCTTGGCCTGTTACTGG - Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935944629 2:108274356-108274378 GACAGCTCTTGGCCTGCTACTGG - Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
937852569 2:126648729-126648751 GACAGCACTTGGCCTGTTACTGG - Intergenic
938247990 2:129793803-129793825 GCCAGATCTCAGCCTGTTCATGG + Intergenic
938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG + Intergenic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
940605915 2:155924279-155924301 GACAGCTCATGGCCTGTTACTGG - Intergenic
941330667 2:164174556-164174578 GACAGCTCTTTGCCTGTTACTGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943317928 2:186412310-186412332 GACAGCTCTTGGTCTGTTACTGG - Intergenic
943384063 2:187181081-187181103 GACAGATCTTTACCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
945725844 2:213471486-213471508 GACAGATGTTGGTCTGTTACTGG - Intronic
946527867 2:220539958-220539980 GACAGCTCTTGGCCCGTTACTGG - Intergenic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
948116393 2:235496457-235496479 TCCAGCTCTGCGTCTGTTACGGG + Intronic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178060754 21:28851129-28851151 AACAGTTCTTGGCCTGTTACTGG - Intergenic
1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1179415149 21:41192512-41192534 GAGAGCTCTTGGCCTGTTACTGG - Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181367436 22:22388935-22388957 GACAGCTCTTGGCCTATTACTGG - Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1184116623 22:42426293-42426315 GCCAGATCTTTGCTTGCTGCTGG - Intronic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
949125664 3:443137-443159 GACAGTTCTTTGCCTGTTACTGG - Intergenic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949245869 3:1924931-1924953 GACAGCTCTTGGTCTGTTACTGG + Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
949638780 3:6012525-6012547 GACAGCTCTCAGCCTGTTACTGG + Intergenic
951122572 3:18945575-18945597 GGCAGCTCTAGGCCTGTTACTGG + Intergenic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951970762 3:28441857-28441879 GACAGCTCTTGGTCTGTTACTGG - Intronic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
956360453 3:68441446-68441468 GATAGCTCTTGGCCTGTTACTGG + Intronic
956509662 3:69980380-69980402 GACAGCTCTTGGCCTATTACTGG + Intergenic
956703894 3:71982879-71982901 GACAGCTCTTGGCCTATTACTGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
960349530 3:116575709-116575731 GACAGCTCTTGGTCTGTTACTGG + Intronic
963331816 3:143923365-143923387 GACAGATCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
964679244 3:159318906-159318928 GACAGCTCATGGCCTGTTACTGG - Intronic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
965251332 3:166348259-166348281 GACAGCTCTTGGTCTGTTACTGG - Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
966445694 3:179998567-179998589 GACAGCTCTTGGTCTGTTACTGG + Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
970956425 4:21817156-21817178 GCCAGTTCTTCCACTGTTGCAGG + Intronic
972107436 4:35507361-35507383 GACAAATCTTCAACTGTTACTGG - Intergenic
972805917 4:42529335-42529357 GACAGCTCTTGGCTTGTTACTGG + Intronic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
973120980 4:46520890-46520912 TACAGCTCTTGGCCTGTTACTGG - Intergenic
973735810 4:53870604-53870626 GCAAGATCTTCCCCTGTGACCGG + Intronic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG + Intergenic
974746914 4:66088897-66088919 GACAGCTCTTGGTCTGTTACTGG - Intergenic
975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG + Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976034205 4:80795814-80795836 GACAGATCTTGGTCTGTTAGTGG - Intronic
976216351 4:82719154-82719176 GCCAGATCTTTCCATGTTTCAGG - Intronic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977626275 4:99192646-99192668 GATAGCTCTTGGCCTGTTACTGG - Intergenic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982835540 4:160116649-160116671 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG + Intergenic
984060283 4:174982016-174982038 GACAGCTCTTGGCCTGCTACTGG - Intergenic
986013479 5:3737799-3737821 GACAGATCTTCACCTGACACAGG - Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
986938331 5:12918742-12918764 GACAGCTCTTGGCCTATTACTGG - Intergenic
986959839 5:13199227-13199249 GTCAGCTCTTTGCCTGTTACTGG + Intergenic
987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG + Intergenic
987468188 5:18296976-18296998 GACAGCTCTTGGCCTATTACTGG - Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
987646373 5:20677321-20677343 GACAGAACTTGGCCTGCTACTGG - Intergenic
987657137 5:20821643-20821665 GACAGGTCTTGGCCTATTACTGG - Intergenic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988160824 5:27516862-27516884 GACAGATCTAGGCCTGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG + Intergenic
988562131 5:32290856-32290878 GACAGCTCTTGGCCCGTTACTGG + Intronic
988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG + Intergenic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
992242956 5:74789876-74789898 AACAGTTCTTGGCCTGTTACTGG + Intronic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993412581 5:87591803-87591825 GGAAGCTCTTGGCCTGTTACTGG - Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994855434 5:105113575-105113597 GACAGCTCTTGGCATGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996018561 5:118567865-118567887 GACAGCTCTTGGTCTGTTACTGG + Intergenic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG + Intronic
998290335 5:140908542-140908564 GACAGCTCTTGGCCTATTACTGG - Intronic
999351386 5:150874854-150874876 GACAGCTCTTGGCCTGTCACTGG + Intronic
1000387441 5:160688077-160688099 TTCAGATCTTCGCCTGCTGCTGG - Exonic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1000646709 5:163768414-163768436 GCCAGCTCTTCGCCTCTCACGGG - Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003791221 6:9550001-9550023 GACAGCTCTTGGCCTATTACTGG + Intergenic
1004824288 6:19403226-19403248 GACAGCTCTTGGACTGTTACTGG - Intergenic
1006001557 6:30969085-30969107 GACAGCTCTTGGCCTATTACTGG + Intergenic
1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG + Intergenic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1009660694 6:66606912-66606934 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011039343 6:83013264-83013286 AACAGGTCTTAGCCTGTTACTGG - Intronic
1011069102 6:83361675-83361697 GACAGCTCCTGGCCTGTTACTGG + Intronic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012820805 6:104082928-104082950 AACAGTTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1013406672 6:109849812-109849834 GACAGTTCTTGGCCAGTTACTGG + Intergenic
1014363396 6:120508344-120508366 GAGAGCTCTTGGCCTGTTACTGG - Intergenic
1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG + Intronic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1016119914 6:140332682-140332704 GACAGTTCTTGGCCTATTACTGG - Intergenic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016174914 6:141069085-141069107 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1016576257 6:145572577-145572599 GACAGCTCTTGGTCTGTTACTGG - Intronic
1017521502 6:155207062-155207084 GCCAGATTTTCGCCTGGGAGGGG + Intronic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024866104 7:53906353-53906375 GACAGTTCTTGGCTTGTTACTGG + Intergenic
1024884342 7:54124645-54124667 GACAGTTCTTTGCCTATTACTGG - Intergenic
1027204130 7:76083596-76083618 GCCAGTTCATTTCCTGTTACTGG - Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028237821 7:88382830-88382852 GACAGCTCTTGGCCTATTACTGG + Intergenic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031474446 7:122205344-122205366 GACAGACCTTGGCCTGTTACTGG - Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1033076258 7:138253054-138253076 GGCAGCTCTTGGCCTCTTACTGG + Intergenic
1035258196 7:157645603-157645625 GCCATATGTTCTCCTGTTATTGG - Intronic
1035317585 7:158006507-158006529 GCCAGATCTTTGCCTGGCGCTGG - Intronic
1035515989 8:232589-232611 GCCAGATCTGCGTCTGTGTCCGG + Exonic
1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG + Intergenic
1042001060 8:64123988-64124010 GACAGCTCTTGGCTTGTTACGGG - Intergenic
1042189804 8:66174550-66174572 GCCATATCTTCTCCTTTTCCTGG + Exonic
1044150800 8:88773083-88773105 GACAGCTCTTTGCCTGTTAGTGG + Intergenic
1044282298 8:90370426-90370448 TCCAGATAGTCGCCTGTTGCTGG + Intergenic
1044487150 8:92767114-92767136 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1044593079 8:93932558-93932580 GCCAGATCTCAGCCTGGCACGGG - Intergenic
1044633154 8:94298398-94298420 GGCAGCTCTTGGCTTGTTACTGG - Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046417637 8:113937786-113937808 GACAGGTCTTGGCCTGTTACTGG - Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1050482675 9:6102611-6102633 GACAGCTCTTGGCCTATTACTGG + Intergenic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1052442269 9:28512274-28512296 GTCAGCTCCTGGCCTGTTACTGG - Intronic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056689431 9:88794111-88794133 GCAAGATCTCCTCCTGTTTCTGG + Intergenic
1057298406 9:93862396-93862418 GCCTGCTCTGTGCCTGTTACTGG + Intergenic
1057446216 9:95116986-95117008 GCCAAGTCTTAGCCTGTTCCTGG + Intronic
1058544165 9:106042742-106042764 GACAGCTCTTGGCCTATTACTGG - Intergenic
1059196505 9:112375860-112375882 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1062135472 9:134925031-134925053 GACAGCTCTTGACCTGTTACAGG + Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1189154883 X:38746714-38746736 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1191095706 X:56671167-56671189 GACAGTTCTTGGCCTATTACTGG - Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191658804 X:63629799-63629821 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1191719241 X:64215702-64215724 GACAGCTCCTCGCCTGTTACTGG - Intergenic
1191759361 X:64629931-64629953 GACAGCTCTCAGCCTGTTACTGG + Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1191941261 X:66483858-66483880 GACAGTCCTTGGCCTGTTACTGG - Intergenic
1192898704 X:75471916-75471938 GACAGCTCTTGGCCTATTACTGG + Intronic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193297781 X:79852680-79852702 AACAGTTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193447157 X:81618777-81618799 GACAGCTCTTGGCCTATTACTGG + Intergenic
1193832948 X:86310103-86310125 GACAGCTCTTGACCTGTTACTGG + Intronic
1193914801 X:87351922-87351944 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1194626616 X:96233172-96233194 GACAGTTCTTGGCCTGCTACTGG + Intergenic
1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG + Intergenic
1194849245 X:98852168-98852190 GACAGCTCTTGGTCTGTTACTGG - Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1196135968 X:112209837-112209859 GACAGCTCTTGGACTGTTACTGG - Intergenic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197097469 X:122612844-122612866 GACAGGTTTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197380000 X:125727899-125727921 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1197591866 X:128419393-128419415 GGCAGCTCTTAGCCTGTTACTGG + Intergenic
1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG + Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG + Intergenic
1199040592 X:143111106-143111128 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1199144441 X:144348959-144348981 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1199310426 X:146314394-146314416 GACAGCTCTTGGCCCGTTACTGG - Intergenic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202134541 Y:21648071-21648093 GAGAGATCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic