ID: 1136821862

View in Genome Browser
Species Human (GRCh38)
Location 16:33325358-33325380
Sequence CCTAATATCCAGACTCCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136821859_1136821862 21 Left 1136821859 16:33325314-33325336 CCAGAATGGGAGGAGATATTCAC No data
Right 1136821862 16:33325358-33325380 CCTAATATCCAGACTCCATAGGG No data
1136821858_1136821862 24 Left 1136821858 16:33325311-33325333 CCTCCAGAATGGGAGGAGATATT No data
Right 1136821862 16:33325358-33325380 CCTAATATCCAGACTCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136821862 Original CRISPR CCTAATATCCAGACTCCATA GGG Intergenic
No off target data available for this crispr