ID: 1136824590

View in Genome Browser
Species Human (GRCh38)
Location 16:33347473-33347495
Sequence AAAGTGGGACTCTAATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136824587_1136824590 -2 Left 1136824587 16:33347452-33347474 CCTGGTGCATTTAGGTGGGGTAA No data
Right 1136824590 16:33347473-33347495 AAAGTGGGACTCTAATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136824590 Original CRISPR AAAGTGGGACTCTAATAGAG AGG Intergenic
No off target data available for this crispr