ID: 1136829678

View in Genome Browser
Species Human (GRCh38)
Location 16:33446356-33446378
Sequence GCCAGATCTTCGCCTGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136829678_1136829681 14 Left 1136829678 16:33446356-33446378 CCTGTAACAGGCGAAGATCTGGC No data
Right 1136829681 16:33446393-33446415 TTCCAGCATCATTGCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136829678 Original CRISPR GCCAGATCTTCGCCTGTTAC AGG (reversed) Intergenic
No off target data available for this crispr