ID: 1136833491

View in Genome Browser
Species Human (GRCh38)
Location 16:33480669-33480691
Sequence CCTAATATCCAGACTCCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136833488_1136833491 21 Left 1136833488 16:33480625-33480647 CCAGAATGGGAGGAGATATTCAC No data
Right 1136833491 16:33480669-33480691 CCTAATATCCAGACTCCATAGGG No data
1136833487_1136833491 24 Left 1136833487 16:33480622-33480644 CCTCCAGAATGGGAGGAGATATT No data
Right 1136833491 16:33480669-33480691 CCTAATATCCAGACTCCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136833491 Original CRISPR CCTAATATCCAGACTCCATA GGG Intergenic
No off target data available for this crispr