ID: 1136838093

View in Genome Browser
Species Human (GRCh38)
Location 16:33516672-33516694
Sequence TATGGAGCAGTCGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136838093_1136838098 -8 Left 1136838093 16:33516672-33516694 CCAGCGGCGGCGACTGCTCCATA No data
Right 1136838098 16:33516687-33516709 GCTCCATATCCACGGGGTCCGGG No data
1136838093_1136838106 29 Left 1136838093 16:33516672-33516694 CCAGCGGCGGCGACTGCTCCATA No data
Right 1136838106 16:33516724-33516746 ATCTAACGGTCCCGCCAGCTAGG No data
1136838093_1136838097 -9 Left 1136838093 16:33516672-33516694 CCAGCGGCGGCGACTGCTCCATA No data
Right 1136838097 16:33516686-33516708 TGCTCCATATCCACGGGGTCCGG No data
1136838093_1136838103 15 Left 1136838093 16:33516672-33516694 CCAGCGGCGGCGACTGCTCCATA No data
Right 1136838103 16:33516710-33516732 CCGCATCCGCCTCGATCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136838093 Original CRISPR TATGGAGCAGTCGCCGCCGC TGG (reversed) Intergenic
No off target data available for this crispr