ID: 1136838693

View in Genome Browser
Species Human (GRCh38)
Location 16:33521029-33521051
Sequence AAACATGAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136838693_1136838702 15 Left 1136838693 16:33521029-33521051 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136838702 16:33521067-33521089 ACCTCTAGCTAGGGGCCAGTGGG No data
1136838693_1136838696 5 Left 1136838693 16:33521029-33521051 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136838696 16:33521057-33521079 TCTTACACCCACCTCTAGCTAGG No data
1136838693_1136838697 6 Left 1136838693 16:33521029-33521051 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136838697 16:33521058-33521080 CTTACACCCACCTCTAGCTAGGG No data
1136838693_1136838704 28 Left 1136838693 16:33521029-33521051 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136838704 16:33521080-33521102 GGCCAGTGGGAACCGCTCCACGG No data
1136838693_1136838701 14 Left 1136838693 16:33521029-33521051 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136838701 16:33521066-33521088 CACCTCTAGCTAGGGGCCAGTGG No data
1136838693_1136838698 7 Left 1136838693 16:33521029-33521051 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136838698 16:33521059-33521081 TTACACCCACCTCTAGCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136838693 Original CRISPR AAACATGAACAAATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr