ID: 1136843079

View in Genome Browser
Species Human (GRCh38)
Location 16:33554811-33554833
Sequence CGGCGCCCAAGCCGACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843079_1136843084 5 Left 1136843079 16:33554811-33554833 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136843084 16:33554839-33554861 GGCGACTGCTCCACATCCACCGG No data
1136843079_1136843086 11 Left 1136843079 16:33554811-33554833 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136843086 16:33554845-33554867 TGCTCCACATCCACCGGGTCCGG No data
1136843079_1136843087 12 Left 1136843079 16:33554811-33554833 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136843087 16:33554846-33554868 GCTCCACATCCACCGGGTCCGGG No data
1136843079_1136843085 6 Left 1136843079 16:33554811-33554833 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136843085 16:33554840-33554862 GCGACTGCTCCACATCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843079 Original CRISPR CGGCGCCCAAGCCGACCCCA GGG (reversed) Intergenic
No off target data available for this crispr