ID: 1136843080

View in Genome Browser
Species Human (GRCh38)
Location 16:33554812-33554834
Sequence CCGGCGCCCAAGCCGACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843080_1136843085 5 Left 1136843080 16:33554812-33554834 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136843085 16:33554840-33554862 GCGACTGCTCCACATCCACCGGG No data
1136843080_1136843086 10 Left 1136843080 16:33554812-33554834 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136843086 16:33554845-33554867 TGCTCCACATCCACCGGGTCCGG No data
1136843080_1136843087 11 Left 1136843080 16:33554812-33554834 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136843087 16:33554846-33554868 GCTCCACATCCACCGGGTCCGGG No data
1136843080_1136843084 4 Left 1136843080 16:33554812-33554834 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136843084 16:33554839-33554861 GGCGACTGCTCCACATCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843080 Original CRISPR CCGGCGCCCAAGCCGACCCC AGG (reversed) Intergenic
No off target data available for this crispr