ID: 1136843083

View in Genome Browser
Species Human (GRCh38)
Location 16:33554831-33554853
Sequence TGTGGAGCAGTCGCCGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843083_1136843096 29 Left 1136843083 16:33554831-33554853 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843083_1136843087 -8 Left 1136843083 16:33554831-33554853 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136843087 16:33554846-33554868 GCTCCACATCCACCGGGTCCGGG No data
1136843083_1136843093 15 Left 1136843083 16:33554831-33554853 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136843093 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
1136843083_1136843086 -9 Left 1136843083 16:33554831-33554853 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136843086 16:33554845-33554867 TGCTCCACATCCACCGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843083 Original CRISPR TGTGGAGCAGTCGCCGCTGC CGG (reversed) Intergenic
No off target data available for this crispr