ID: 1136843087

View in Genome Browser
Species Human (GRCh38)
Location 16:33554846-33554868
Sequence GCTCCACATCCACCGGGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843080_1136843087 11 Left 1136843080 16:33554812-33554834 CCTGGGGTCGGCTTGGGCGCCGG No data
Right 1136843087 16:33554846-33554868 GCTCCACATCCACCGGGTCCGGG No data
1136843079_1136843087 12 Left 1136843079 16:33554811-33554833 CCCTGGGGTCGGCTTGGGCGCCG No data
Right 1136843087 16:33554846-33554868 GCTCCACATCCACCGGGTCCGGG No data
1136843074_1136843087 27 Left 1136843074 16:33554796-33554818 CCTTGCGGGGGTCGGCCCTGGGG No data
Right 1136843087 16:33554846-33554868 GCTCCACATCCACCGGGTCCGGG No data
1136843083_1136843087 -8 Left 1136843083 16:33554831-33554853 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136843087 16:33554846-33554868 GCTCCACATCCACCGGGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843087 Original CRISPR GCTCCACATCCACCGGGTCC GGG Intergenic
No off target data available for this crispr