ID: 1136843089

View in Genome Browser
Species Human (GRCh38)
Location 16:33554855-33554877
Sequence CGGACGCGGCCCGGACCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843089_1136843096 5 Left 1136843089 16:33554855-33554877 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843089_1136843100 23 Left 1136843089 16:33554855-33554877 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136843100 16:33554901-33554923 CTAGGCGCGCTCGCCAGTTCCGG No data
1136843089_1136843093 -9 Left 1136843089 16:33554855-33554877 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136843093 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
1136843089_1136843101 24 Left 1136843089 16:33554855-33554877 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136843101 16:33554902-33554924 TAGGCGCGCTCGCCAGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843089 Original CRISPR CGGACGCGGCCCGGACCCGG TGG (reversed) Intergenic
No off target data available for this crispr