ID: 1136843091

View in Genome Browser
Species Human (GRCh38)
Location 16:33554864-33554886
Sequence AGCTCGAGGCGGACGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843091_1136843096 -4 Left 1136843091 16:33554864-33554886 CCGGGCCGCGTCCGCCTCGAGCT No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843091_1136843101 15 Left 1136843091 16:33554864-33554886 CCGGGCCGCGTCCGCCTCGAGCT No data
Right 1136843101 16:33554902-33554924 TAGGCGCGCTCGCCAGTTCCGGG No data
1136843091_1136843100 14 Left 1136843091 16:33554864-33554886 CCGGGCCGCGTCCGCCTCGAGCT No data
Right 1136843100 16:33554901-33554923 CTAGGCGCGCTCGCCAGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843091 Original CRISPR AGCTCGAGGCGGACGCGGCC CGG (reversed) Intergenic
No off target data available for this crispr