ID: 1136843092

View in Genome Browser
Species Human (GRCh38)
Location 16:33554869-33554891
Sequence CCGTTAGCTCGAGGCGGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843092_1136843096 -9 Left 1136843092 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843092_1136843100 9 Left 1136843092 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
Right 1136843100 16:33554901-33554923 CTAGGCGCGCTCGCCAGTTCCGG No data
1136843092_1136843101 10 Left 1136843092 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
Right 1136843101 16:33554902-33554924 TAGGCGCGCTCGCCAGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843092 Original CRISPR CCGTTAGCTCGAGGCGGACG CGG (reversed) Intergenic
No off target data available for this crispr