ID: 1136843093

View in Genome Browser
Species Human (GRCh38)
Location 16:33554869-33554891
Sequence CCGCGTCCGCCTCGAGCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843089_1136843093 -9 Left 1136843089 16:33554855-33554877 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136843093 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
1136843088_1136843093 -3 Left 1136843088 16:33554849-33554871 CCACATCCACCGGGTCCGGGCCG No data
Right 1136843093 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
1136843083_1136843093 15 Left 1136843083 16:33554831-33554853 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136843093 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843093 Original CRISPR CCGCGTCCGCCTCGAGCTAA CGG Intergenic
No off target data available for this crispr