ID: 1136843096

View in Genome Browser
Species Human (GRCh38)
Location 16:33554883-33554905
Sequence AGCTAACGGTCCCGCCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843089_1136843096 5 Left 1136843089 16:33554855-33554877 CCACCGGGTCCGGGCCGCGTCCG No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843091_1136843096 -4 Left 1136843091 16:33554864-33554886 CCGGGCCGCGTCCGCCTCGAGCT No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843090_1136843096 2 Left 1136843090 16:33554858-33554880 CCGGGTCCGGGCCGCGTCCGCCT No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843088_1136843096 11 Left 1136843088 16:33554849-33554871 CCACATCCACCGGGTCCGGGCCG No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843083_1136843096 29 Left 1136843083 16:33554831-33554853 CCGGCAGCGGCGACTGCTCCACA No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data
1136843092_1136843096 -9 Left 1136843092 16:33554869-33554891 CCGCGTCCGCCTCGAGCTAACGG No data
Right 1136843096 16:33554883-33554905 AGCTAACGGTCCCGCCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843096 Original CRISPR AGCTAACGGTCCCGCCAGCT AGG Intergenic
No off target data available for this crispr