ID: 1136843702

View in Genome Browser
Species Human (GRCh38)
Location 16:33559203-33559225
Sequence AAACATGAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843702_1136843708 7 Left 1136843702 16:33559203-33559225 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136843708 16:33559233-33559255 CTACACCCACCTCTAGCTAGGGG No data
1136843702_1136843712 15 Left 1136843702 16:33559203-33559225 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136843712 16:33559241-33559263 ACCTCTAGCTAGGGGCCAGTGGG No data
1136843702_1136843711 14 Left 1136843702 16:33559203-33559225 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136843711 16:33559240-33559262 CACCTCTAGCTAGGGGCCAGTGG No data
1136843702_1136843705 5 Left 1136843702 16:33559203-33559225 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136843705 16:33559231-33559253 TCCTACACCCACCTCTAGCTAGG No data
1136843702_1136843707 6 Left 1136843702 16:33559203-33559225 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136843707 16:33559232-33559254 CCTACACCCACCTCTAGCTAGGG No data
1136843702_1136843714 28 Left 1136843702 16:33559203-33559225 CCCAGCTCCATTTGTTCATGTTT No data
Right 1136843714 16:33559254-33559276 GGCCAGTGGGATCCGCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843702 Original CRISPR AAACATGAACAAATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr