ID: 1136843780

View in Genome Browser
Species Human (GRCh38)
Location 16:33559670-33559692
Sequence TTCCCTACCCCATTAAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136843780_1136843783 14 Left 1136843780 16:33559670-33559692 CCATAACTTAATGGGGTAGGGAA No data
Right 1136843783 16:33559707-33559729 GATAAAATTAAAGTGACGTTAGG No data
1136843780_1136843784 19 Left 1136843780 16:33559670-33559692 CCATAACTTAATGGGGTAGGGAA No data
Right 1136843784 16:33559712-33559734 AATTAAAGTGACGTTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136843780 Original CRISPR TTCCCTACCCCATTAAGTTA TGG (reversed) Intergenic
No off target data available for this crispr