ID: 1136844472

View in Genome Browser
Species Human (GRCh38)
Location 16:33565232-33565254
Sequence ACCACAGTGGGGAAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136844465_1136844472 -3 Left 1136844465 16:33565212-33565234 CCTCCCACTGAGCCAAGCATACC 0: 9
1: 1
2: 2
3: 11
4: 127
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844463_1136844472 1 Left 1136844463 16:33565208-33565230 CCCTCCTCCCACTGAGCCAAGCA 0: 9
1: 2
2: 3
3: 36
4: 302
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844457_1136844472 17 Left 1136844457 16:33565192-33565214 CCCACCCAACTCCAGCCCCTCCT 0: 11
1: 1
2: 8
3: 85
4: 991
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844464_1136844472 0 Left 1136844464 16:33565209-33565231 CCTCCTCCCACTGAGCCAAGCAT 0: 9
1: 2
2: 4
3: 29
4: 362
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844462_1136844472 2 Left 1136844462 16:33565207-33565229 CCCCTCCTCCCACTGAGCCAAGC 0: 9
1: 2
2: 3
3: 30
4: 322
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844459_1136844472 13 Left 1136844459 16:33565196-33565218 CCCAACTCCAGCCCCTCCTCCCA 0: 9
1: 3
2: 24
3: 193
4: 1214
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844458_1136844472 16 Left 1136844458 16:33565193-33565215 CCACCCAACTCCAGCCCCTCCTC 0: 10
1: 2
2: 13
3: 142
4: 1368
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844467_1136844472 -7 Left 1136844467 16:33565216-33565238 CCACTGAGCCAAGCATACCACAG 0: 11
1: 0
2: 0
3: 15
4: 202
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844460_1136844472 12 Left 1136844460 16:33565197-33565219 CCAACTCCAGCCCCTCCTCCCAC 0: 9
1: 5
2: 19
3: 240
4: 1946
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844456_1136844472 30 Left 1136844456 16:33565179-33565201 CCTCATGTACTTTCCCACCCAAC 0: 11
1: 1
2: 1
3: 15
4: 187
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844466_1136844472 -6 Left 1136844466 16:33565215-33565237 CCCACTGAGCCAAGCATACCACA No data
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data
1136844461_1136844472 6 Left 1136844461 16:33565203-33565225 CCAGCCCCTCCTCCCACTGAGCC 0: 9
1: 2
2: 18
3: 654
4: 1271
Right 1136844472 16:33565232-33565254 ACCACAGTGGGGAAAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136844472 Original CRISPR ACCACAGTGGGGAAAGAGAG AGG Intergenic
No off target data available for this crispr