ID: 1136849929

View in Genome Browser
Species Human (GRCh38)
Location 16:33604440-33604462
Sequence CCAAGGAAGGCTTTGTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136849929_1136849937 17 Left 1136849929 16:33604440-33604462 CCATATCACAAAGCCTTCCTTGG No data
Right 1136849937 16:33604480-33604502 TGCCTGCAATTCCAGCACTTTGG 0: 113
1: 6522
2: 106509
3: 241665
4: 244348
1136849929_1136849935 -10 Left 1136849929 16:33604440-33604462 CCATATCACAAAGCCTTCCTTGG No data
Right 1136849935 16:33604453-33604475 CCTTCCTTGGCTGGGTGTGGTGG No data
1136849929_1136849943 30 Left 1136849929 16:33604440-33604462 CCATATCACAAAGCCTTCCTTGG No data
Right 1136849943 16:33604493-33604515 AGCACTTTGGGAGGCTGAGGTGG 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
1136849929_1136849941 27 Left 1136849929 16:33604440-33604462 CCATATCACAAAGCCTTCCTTGG No data
Right 1136849941 16:33604490-33604512 TCCAGCACTTTGGGAGGCTGAGG 0: 4261
1: 95514
2: 216800
3: 242347
4: 268001
1136849929_1136849938 18 Left 1136849929 16:33604440-33604462 CCATATCACAAAGCCTTCCTTGG No data
Right 1136849938 16:33604481-33604503 GCCTGCAATTCCAGCACTTTGGG 0: 157
1: 12624
2: 239438
3: 275156
4: 180926
1136849929_1136849940 21 Left 1136849929 16:33604440-33604462 CCATATCACAAAGCCTTCCTTGG No data
Right 1136849940 16:33604484-33604506 TGCAATTCCAGCACTTTGGGAGG 0: 228
1: 17611
2: 315017
3: 263798
4: 149065

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136849929 Original CRISPR CCAAGGAAGGCTTTGTGATA TGG (reversed) Intergenic
No off target data available for this crispr