ID: 1136850104

View in Genome Browser
Species Human (GRCh38)
Location 16:33605794-33605816
Sequence GCCCCCTTTATCCCCCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136850104_1136850106 25 Left 1136850104 16:33605794-33605816 CCCTTAAGGGGGATAAAGGGGGC No data
Right 1136850106 16:33605842-33605864 TCTGTCTGTCTCTCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136850104 Original CRISPR GCCCCCTTTATCCCCCTTAA GGG (reversed) Intergenic
No off target data available for this crispr