ID: 1136850916

View in Genome Browser
Species Human (GRCh38)
Location 16:33611706-33611728
Sequence CGGATGATGTGGAGTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136850916_1136850927 20 Left 1136850916 16:33611706-33611728 CCTCCTGGACTCCACATCATCCG No data
Right 1136850927 16:33611749-33611771 CTGGGCAGTCAGTAGTGGCGTGG No data
1136850916_1136850922 2 Left 1136850916 16:33611706-33611728 CCTCCTGGACTCCACATCATCCG No data
Right 1136850922 16:33611731-33611753 GTGAGCACTGACACCTCCCTGGG No data
1136850916_1136850921 1 Left 1136850916 16:33611706-33611728 CCTCCTGGACTCCACATCATCCG No data
Right 1136850921 16:33611730-33611752 GGTGAGCACTGACACCTCCCTGG No data
1136850916_1136850924 15 Left 1136850916 16:33611706-33611728 CCTCCTGGACTCCACATCATCCG No data
Right 1136850924 16:33611744-33611766 CCTCCCTGGGCAGTCAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136850916 Original CRISPR CGGATGATGTGGAGTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr