ID: 1136850916 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:33611706-33611728 |
Sequence | CGGATGATGTGGAGTCCAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1136850916_1136850927 | 20 | Left | 1136850916 | 16:33611706-33611728 | CCTCCTGGACTCCACATCATCCG | No data | ||
Right | 1136850927 | 16:33611749-33611771 | CTGGGCAGTCAGTAGTGGCGTGG | No data | ||||
1136850916_1136850922 | 2 | Left | 1136850916 | 16:33611706-33611728 | CCTCCTGGACTCCACATCATCCG | No data | ||
Right | 1136850922 | 16:33611731-33611753 | GTGAGCACTGACACCTCCCTGGG | No data | ||||
1136850916_1136850921 | 1 | Left | 1136850916 | 16:33611706-33611728 | CCTCCTGGACTCCACATCATCCG | No data | ||
Right | 1136850921 | 16:33611730-33611752 | GGTGAGCACTGACACCTCCCTGG | No data | ||||
1136850916_1136850924 | 15 | Left | 1136850916 | 16:33611706-33611728 | CCTCCTGGACTCCACATCATCCG | No data | ||
Right | 1136850924 | 16:33611744-33611766 | CCTCCCTGGGCAGTCAGTAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1136850916 | Original CRISPR | CGGATGATGTGGAGTCCAGG AGG (reversed) | Intergenic | ||
No off target data available for this crispr |