ID: 1136852465

View in Genome Browser
Species Human (GRCh38)
Location 16:33623706-33623728
Sequence CCTAACCAGCACCAGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136852456_1136852465 8 Left 1136852456 16:33623675-33623697 CCTTTTCAACCCCAACTCCCACT No data
Right 1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG No data
1136852459_1136852465 -2 Left 1136852459 16:33623685-33623707 CCCAACTCCCACTGGTCTAATCC No data
Right 1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG No data
1136852458_1136852465 -1 Left 1136852458 16:33623684-33623706 CCCCAACTCCCACTGGTCTAATC No data
Right 1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG No data
1136852460_1136852465 -3 Left 1136852460 16:33623686-33623708 CCAACTCCCACTGGTCTAATCCT No data
Right 1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG No data
1136852462_1136852465 -10 Left 1136852462 16:33623693-33623715 CCACTGGTCTAATCCTAACCAGC No data
Right 1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG No data
1136852461_1136852465 -9 Left 1136852461 16:33623692-33623714 CCCACTGGTCTAATCCTAACCAG No data
Right 1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136852465 Original CRISPR CCTAACCAGCACCAGCTGGT TGG Intergenic
No off target data available for this crispr