ID: 1136854002

View in Genome Browser
Species Human (GRCh38)
Location 16:33638358-33638380
Sequence ACTGATTATCAGTTTTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136854000_1136854002 21 Left 1136854000 16:33638314-33638336 CCTTTCTGTGTATTGGTTATTCA No data
Right 1136854002 16:33638358-33638380 ACTGATTATCAGTTTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136854002 Original CRISPR ACTGATTATCAGTTTTTGTG AGG Intergenic
No off target data available for this crispr