ID: 1136857088

View in Genome Browser
Species Human (GRCh38)
Location 16:33667193-33667215
Sequence AGCAACTTGAAGCCTGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136857083_1136857088 30 Left 1136857083 16:33667140-33667162 CCGAAATCTCCAGAACATATTTG No data
Right 1136857088 16:33667193-33667215 AGCAACTTGAAGCCTGGTGAGGG No data
1136857084_1136857088 21 Left 1136857084 16:33667149-33667171 CCAGAACATATTTGAAATTATTT No data
Right 1136857088 16:33667193-33667215 AGCAACTTGAAGCCTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136857088 Original CRISPR AGCAACTTGAAGCCTGGTGA GGG Intergenic
No off target data available for this crispr