ID: 1136857145

View in Genome Browser
Species Human (GRCh38)
Location 16:33667781-33667803
Sequence AATGAACGCCTCCTCGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136857139_1136857145 11 Left 1136857139 16:33667747-33667769 CCCAGAGGAACGATGGAGAGATA No data
Right 1136857145 16:33667781-33667803 AATGAACGCCTCCTCGGGGATGG No data
1136857140_1136857145 10 Left 1136857140 16:33667748-33667770 CCAGAGGAACGATGGAGAGATAG No data
Right 1136857145 16:33667781-33667803 AATGAACGCCTCCTCGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136857145 Original CRISPR AATGAACGCCTCCTCGGGGA TGG Intergenic
No off target data available for this crispr