ID: 1136857146

View in Genome Browser
Species Human (GRCh38)
Location 16:33667782-33667804
Sequence ATGAACGCCTCCTCGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136857139_1136857146 12 Left 1136857139 16:33667747-33667769 CCCAGAGGAACGATGGAGAGATA No data
Right 1136857146 16:33667782-33667804 ATGAACGCCTCCTCGGGGATGGG No data
1136857140_1136857146 11 Left 1136857140 16:33667748-33667770 CCAGAGGAACGATGGAGAGATAG No data
Right 1136857146 16:33667782-33667804 ATGAACGCCTCCTCGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136857146 Original CRISPR ATGAACGCCTCCTCGGGGAT GGG Intergenic