ID: 1136862060

View in Genome Browser
Species Human (GRCh38)
Location 16:33710421-33710443
Sequence CCTGGCACGGAGCAGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136862060_1136862072 29 Left 1136862060 16:33710421-33710443 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1136862072 16:33710473-33710495 ACCACGGCTCGCCTCCCTGCAGG No data
1136862060_1136862069 13 Left 1136862060 16:33710421-33710443 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1136862069 16:33710457-33710479 ACCTAGAGCCTGCAACACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136862060 Original CRISPR CCTGGCACGGAGCAGCTGGG CGG (reversed) Intergenic
No off target data available for this crispr