ID: 1136862749

View in Genome Browser
Species Human (GRCh38)
Location 16:33712980-33713002
Sequence GCCCTGCCCTGAGCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136862743_1136862749 -7 Left 1136862743 16:33712964-33712986 CCCTGCCCTCCCTTTGGCCCTGC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862733_1136862749 29 Left 1136862733 16:33712928-33712950 CCTACCTTAACCCTGTGCTACCC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862739_1136862749 8 Left 1136862739 16:33712949-33712971 CCTGGACCTGCTCCACCCTGCCC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862738_1136862749 9 Left 1136862738 16:33712948-33712970 CCCTGGACCTGCTCCACCCTGCC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862740_1136862749 2 Left 1136862740 16:33712955-33712977 CCTGCTCCACCCTGCCCTCCCTT No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862744_1136862749 -8 Left 1136862744 16:33712965-33712987 CCTGCCCTCCCTTTGGCCCTGCC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862735_1136862749 25 Left 1136862735 16:33712932-33712954 CCTTAACCCTGTGCTACCCTGGA No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862742_1136862749 -4 Left 1136862742 16:33712961-33712983 CCACCCTGCCCTCCCTTTGGCCC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862737_1136862749 18 Left 1136862737 16:33712939-33712961 CCTGTGCTACCCTGGACCTGCTC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862732_1136862749 30 Left 1136862732 16:33712927-33712949 CCCTACCTTAACCCTGTGCTACC No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data
1136862736_1136862749 19 Left 1136862736 16:33712938-33712960 CCCTGTGCTACCCTGGACCTGCT No data
Right 1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136862749 Original CRISPR GCCCTGCCCTGAGCCCGCCT TGG Intergenic
No off target data available for this crispr