ID: 1136863278

View in Genome Browser
Species Human (GRCh38)
Location 16:33715802-33715824
Sequence CAGAGGACAGTGAAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136863278_1136863284 29 Left 1136863278 16:33715802-33715824 CCTGGCCACTTCACTGTCCTCTG No data
Right 1136863284 16:33715854-33715876 CAAGACTCTAGTTAATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136863278 Original CRISPR CAGAGGACAGTGAAGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr