ID: 1136872099

View in Genome Browser
Species Human (GRCh38)
Location 16:33816724-33816746
Sequence AGCGCCCCCTGGTGGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136872099_1136872106 -8 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872106 16:33816739-33816761 GGGGCGCTGAGGACACCAGGGGG No data
1136872099_1136872104 -10 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872104 16:33816737-33816759 AGGGGGCGCTGAGGACACCAGGG No data
1136872099_1136872110 20 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872110 16:33816767-33816789 AGGATCACCAAGGAATGCCCAGG No data
1136872099_1136872112 29 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872112 16:33816776-33816798 AAGGAATGCCCAGGACCATTAGG No data
1136872099_1136872109 10 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872109 16:33816757-33816779 GGGGGCATTCAGGATCACCAAGG No data
1136872099_1136872105 -9 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872105 16:33816738-33816760 GGGGGCGCTGAGGACACCAGGGG No data
1136872099_1136872113 30 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872113 16:33816777-33816799 AGGAATGCCCAGGACCATTAGGG No data
1136872099_1136872107 0 Left 1136872099 16:33816724-33816746 CCTCAGAACCACCAGGGGGCGCT No data
Right 1136872107 16:33816747-33816769 GAGGACACCAGGGGGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136872099 Original CRISPR AGCGCCCCCTGGTGGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr