ID: 1136873472

View in Genome Browser
Species Human (GRCh38)
Location 16:33828768-33828790
Sequence TTGTCCTAGATGAACTTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136873472_1136873475 6 Left 1136873472 16:33828768-33828790 CCGACCAAGTTCATCTAGGACAA No data
Right 1136873475 16:33828797-33828819 TGACCTAGAGAAGTGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136873472 Original CRISPR TTGTCCTAGATGAACTTGGT CGG (reversed) Intergenic
No off target data available for this crispr