ID: 1136878763

View in Genome Browser
Species Human (GRCh38)
Location 16:33885482-33885504
Sequence TGGGCTTCCCCCGAGCGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136878763_1136878775 28 Left 1136878763 16:33885482-33885504 CCCAACCGCTCGGGGGAAGCCCA No data
Right 1136878775 16:33885533-33885555 GTTCCTGCACATTTATGGGCTGG No data
1136878763_1136878776 29 Left 1136878763 16:33885482-33885504 CCCAACCGCTCGGGGGAAGCCCA No data
Right 1136878776 16:33885534-33885556 TTCCTGCACATTTATGGGCTGGG No data
1136878763_1136878774 24 Left 1136878763 16:33885482-33885504 CCCAACCGCTCGGGGGAAGCCCA No data
Right 1136878774 16:33885529-33885551 TTTGGTTCCTGCACATTTATGGG No data
1136878763_1136878770 6 Left 1136878763 16:33885482-33885504 CCCAACCGCTCGGGGGAAGCCCA No data
Right 1136878770 16:33885511-33885533 TTTGCATCTTTCTTTCCCTTTGG No data
1136878763_1136878773 23 Left 1136878763 16:33885482-33885504 CCCAACCGCTCGGGGGAAGCCCA No data
Right 1136878773 16:33885528-33885550 CTTTGGTTCCTGCACATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136878763 Original CRISPR TGGGCTTCCCCCGAGCGGTT GGG (reversed) Intergenic
No off target data available for this crispr