ID: 1136881946

View in Genome Browser
Species Human (GRCh38)
Location 16:33907565-33907587
Sequence GGCACCCCCCTCTGGGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136881946_1136881956 13 Left 1136881946 16:33907565-33907587 CCGACCCCCCAGAGGGGGGTGCC No data
Right 1136881956 16:33907601-33907623 CCGTGTCTCCTCCATCAGACTGG No data
1136881946_1136881959 22 Left 1136881946 16:33907565-33907587 CCGACCCCCCAGAGGGGGGTGCC No data
Right 1136881959 16:33907610-33907632 CTCCATCAGACTGGGCTCACTGG No data
1136881946_1136881960 23 Left 1136881946 16:33907565-33907587 CCGACCCCCCAGAGGGGGGTGCC No data
Right 1136881960 16:33907611-33907633 TCCATCAGACTGGGCTCACTGGG No data
1136881946_1136881964 29 Left 1136881946 16:33907565-33907587 CCGACCCCCCAGAGGGGGGTGCC No data
Right 1136881964 16:33907617-33907639 AGACTGGGCTCACTGGGGCAGGG No data
1136881946_1136881957 14 Left 1136881946 16:33907565-33907587 CCGACCCCCCAGAGGGGGGTGCC No data
Right 1136881957 16:33907602-33907624 CGTGTCTCCTCCATCAGACTGGG No data
1136881946_1136881963 28 Left 1136881946 16:33907565-33907587 CCGACCCCCCAGAGGGGGGTGCC No data
Right 1136881963 16:33907616-33907638 CAGACTGGGCTCACTGGGGCAGG No data
1136881946_1136881962 24 Left 1136881946 16:33907565-33907587 CCGACCCCCCAGAGGGGGGTGCC No data
Right 1136881962 16:33907612-33907634 CCATCAGACTGGGCTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136881946 Original CRISPR GGCACCCCCCTCTGGGGGGT CGG (reversed) Intergenic
No off target data available for this crispr