ID: 1136882856

View in Genome Browser
Species Human (GRCh38)
Location 16:33913541-33913563
Sequence CAAGCACCCTAGACACTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136882856_1136882865 27 Left 1136882856 16:33913541-33913563 CCCTAAAGTGTCTAGGGTGCTTG No data
Right 1136882865 16:33913591-33913613 GCTGCCAGTCTTATTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136882856 Original CRISPR CAAGCACCCTAGACACTTTA GGG (reversed) Intergenic
No off target data available for this crispr