ID: 1136882865

View in Genome Browser
Species Human (GRCh38)
Location 16:33913591-33913613
Sequence GCTGCCAGTCTTATTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136882856_1136882865 27 Left 1136882856 16:33913541-33913563 CCCTAAAGTGTCTAGGGTGCTTG No data
Right 1136882865 16:33913591-33913613 GCTGCCAGTCTTATTTCCCCTGG No data
1136882862_1136882865 -9 Left 1136882862 16:33913577-33913599 CCTTCCTCTGACCAGCTGCCAGT No data
Right 1136882865 16:33913591-33913613 GCTGCCAGTCTTATTTCCCCTGG No data
1136882857_1136882865 26 Left 1136882857 16:33913542-33913564 CCTAAAGTGTCTAGGGTGCTTGG No data
Right 1136882865 16:33913591-33913613 GCTGCCAGTCTTATTTCCCCTGG No data
1136882861_1136882865 -8 Left 1136882861 16:33913576-33913598 CCCTTCCTCTGACCAGCTGCCAG No data
Right 1136882865 16:33913591-33913613 GCTGCCAGTCTTATTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136882865 Original CRISPR GCTGCCAGTCTTATTTCCCC TGG Intergenic
No off target data available for this crispr