ID: 1136882946

View in Genome Browser
Species Human (GRCh38)
Location 16:33913965-33913987
Sequence CTGGCCCCACTGAGGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136882946_1136882954 0 Left 1136882946 16:33913965-33913987 CCCCAAAACCTCAGTGGGGCCAG No data
Right 1136882954 16:33913988-33914010 CAGGGAAAGTCACTAGAGCCGGG No data
1136882946_1136882955 1 Left 1136882946 16:33913965-33913987 CCCCAAAACCTCAGTGGGGCCAG No data
Right 1136882955 16:33913989-33914011 AGGGAAAGTCACTAGAGCCGGGG No data
1136882946_1136882960 27 Left 1136882946 16:33913965-33913987 CCCCAAAACCTCAGTGGGGCCAG No data
Right 1136882960 16:33914015-33914037 CCTGATGTCAGGCCAGACCTTGG No data
1136882946_1136882956 16 Left 1136882946 16:33913965-33913987 CCCCAAAACCTCAGTGGGGCCAG No data
Right 1136882956 16:33914004-33914026 AGCCGGGGCCTCCTGATGTCAGG No data
1136882946_1136882953 -1 Left 1136882946 16:33913965-33913987 CCCCAAAACCTCAGTGGGGCCAG No data
Right 1136882953 16:33913987-33914009 GCAGGGAAAGTCACTAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136882946 Original CRISPR CTGGCCCCACTGAGGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr