ID: 1136885201

View in Genome Browser
Species Human (GRCh38)
Location 16:33926846-33926868
Sequence CATGGAGGAGGTGCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136885196_1136885201 -3 Left 1136885196 16:33926826-33926848 CCTGGCAGATGCTGAGCAGGCAT No data
Right 1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG No data
1136885194_1136885201 4 Left 1136885194 16:33926819-33926841 CCACTTTCCTGGCAGATGCTGAG No data
Right 1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136885201 Original CRISPR CATGGAGGAGGTGCCCCAGG AGG Intergenic
No off target data available for this crispr