ID: 1136885385

View in Genome Browser
Species Human (GRCh38)
Location 16:33927783-33927805
Sequence GAGCAGGCTCTGATGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136885385_1136885390 21 Left 1136885385 16:33927783-33927805 CCACTCCACATCAGAGCCTGCTC No data
Right 1136885390 16:33927827-33927849 CAATAATCCCTGTCATCATTAGG No data
1136885385_1136885392 27 Left 1136885385 16:33927783-33927805 CCACTCCACATCAGAGCCTGCTC No data
Right 1136885392 16:33927833-33927855 TCCCTGTCATCATTAGGGTCAGG No data
1136885385_1136885391 22 Left 1136885385 16:33927783-33927805 CCACTCCACATCAGAGCCTGCTC No data
Right 1136885391 16:33927828-33927850 AATAATCCCTGTCATCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136885385 Original CRISPR GAGCAGGCTCTGATGTGGAG TGG (reversed) Intergenic
No off target data available for this crispr