ID: 1136891512

View in Genome Browser
Species Human (GRCh38)
Location 16:33975557-33975579
Sequence GTGAGCCGGGCAGCCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136891507_1136891512 -8 Left 1136891507 16:33975542-33975564 CCACCGGAGTCTCGGGTGAGCCG No data
Right 1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG No data
1136891499_1136891512 10 Left 1136891499 16:33975524-33975546 CCTGAGCCGCCGCCGCCGCCACC No data
Right 1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG No data
1136891506_1136891512 -5 Left 1136891506 16:33975539-33975561 CCGCCACCGGAGTCTCGGGTGAG No data
Right 1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG No data
1136891502_1136891512 1 Left 1136891502 16:33975533-33975555 CCGCCGCCGCCACCGGAGTCTCG No data
Right 1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG No data
1136891505_1136891512 -2 Left 1136891505 16:33975536-33975558 CCGCCGCCACCGGAGTCTCGGGT No data
Right 1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG No data
1136891501_1136891512 4 Left 1136891501 16:33975530-33975552 CCGCCGCCGCCGCCACCGGAGTC No data
Right 1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136891512 Original CRISPR GTGAGCCGGGCAGCCGCCGC GGG Intergenic
No off target data available for this crispr