ID: 1136891700

View in Genome Browser
Species Human (GRCh38)
Location 16:33976133-33976155
Sequence GCCCGCGGGGCCGTCGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136891700_1136891716 29 Left 1136891700 16:33976133-33976155 CCAAGGGCGACGGCCCCGCGGGC No data
Right 1136891716 16:33976185-33976207 GCCGCCGCGCGCGATAGACCTGG No data
1136891700_1136891706 -9 Left 1136891700 16:33976133-33976155 CCAAGGGCGACGGCCCCGCGGGC No data
Right 1136891706 16:33976147-33976169 CCCGCGGGCCTGGGGACACCCGG No data
1136891700_1136891711 2 Left 1136891700 16:33976133-33976155 CCAAGGGCGACGGCCCCGCGGGC No data
Right 1136891711 16:33976158-33976180 GGGGACACCCGGCGGCGGCCTGG No data
1136891700_1136891708 -6 Left 1136891700 16:33976133-33976155 CCAAGGGCGACGGCCCCGCGGGC No data
Right 1136891708 16:33976150-33976172 GCGGGCCTGGGGACACCCGGCGG No data
1136891700_1136891709 -3 Left 1136891700 16:33976133-33976155 CCAAGGGCGACGGCCCCGCGGGC No data
Right 1136891709 16:33976153-33976175 GGCCTGGGGACACCCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136891700 Original CRISPR GCCCGCGGGGCCGTCGCCCT TGG (reversed) Intergenic
No off target data available for this crispr