ID: 1136891955

View in Genome Browser
Species Human (GRCh38)
Location 16:33977029-33977051
Sequence CAAAGTTAGGAGAAGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136891946_1136891955 22 Left 1136891946 16:33976984-33977006 CCAGTGATGGGTGGGAAACAGAG 0: 4
1: 0
2: 1
3: 24
4: 240
Right 1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG No data
1136891945_1136891955 23 Left 1136891945 16:33976983-33977005 CCCAGTGATGGGTGGGAAACAGA No data
Right 1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG No data
1136891949_1136891955 -3 Left 1136891949 16:33977009-33977031 CCAGAGCAAAGGCCTTTGCCCAA 0: 4
1: 0
2: 2
3: 15
4: 190
Right 1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136891955 Original CRISPR CAAAGTTAGGAGAAGGATGC TGG Intergenic
No off target data available for this crispr